Biotechnology Index Glossary
Bacteriophage RNA Polymerases
Phage-encoded DNA-dependent RNA polymerases are used for in vitro transcription to generate defined RNAs. Most commonly, the reaction utilizes ribonucleotides that are labeled with radionuclides or some other tag, and the resulting labeled RNA is used as a probe for hybridization. Other applications of in vitro transcription including making RNAs for in vitro translation or to study RNA struction and function.
Several bacteriophage RNA polymerases are commercially available. They are named after the phage that encodes them, and either purified from phage-infected bacteria or produced as recombinant proteins:
Polymerase Name Host of Encoding Phage Promoter Sequence T7 RNA polymerase E. coli TAATACGACTCACTATAGGG T3 RNA polymerase E. coli AATTAACCCTCACTAAAGGG SP6 RNA polymerase Salmonella typhimurium AATTTAGGTGACACTATAGAA
Many of the plasmids used for carrying cloned DNA incorporate promoters for bacteriophage RNA polymerases adjacent to the cloning site. This allows one to readily obtain either mRNA-sense or antisense transcripts from the inserted DNA. The process is often called run-off transcription, because the plasmid is cut with a restriction enzyme downstream of the inserted DNA, which causes the polymerase to fall off the template when it reaches that spot.
If we assume that the RNA transcribed in the figure above has the polarity of a mRNA (e.g. sense), it is easy to modify the construct to express an antisense RNA - simply reverse the orientation of the transcribed region. Indeed, most plasmids used for in vitro transcription have two different phage polymerase promoters flanking the insertion site, which allows transcription of sense RNA with one polymerase and antisense with the other.
Back to the index of Restriction Endonucleases and DNA Modifying Enzymes
Last updated on December 26, 1999Send comments via form or email to rbowen@lamar.colostate.edu